4 Week 3- Working with Files Part 2

We now know how to switch directories and view the contents of directories and files, but how do we manipulate files?

4.1 Main Objectives

  • Create, copy and delete files/directories
  • Modify permissions for a file
  • Construct command pipelines with two or more stages
  • Practice writing scripts to work with data in terminal

4.2 Warmup: Viewing fastq files

Navigate to /group/rbaygrp/eve198-genomics/week3_warmup. Answer the following questions about the file zostera_RNA_subsampled.fastq

  1. What’s the most common quality (phred) score in the first read?
  2. How many times does the sequence “AAAAAAAAAAAAAAAAAAAA” (20 ’A’s in a row!) show up in this file?
  3. Using less, try searching for low quality reads by searching for !, which represents a quality score of zero. What happens when you use a normal search pattern on the symbol !? Google to find a way to search for a ! in the file. Can you find any?

4.3 Creating, moving, copying, and removing

Now we can move around in the file structure, look at files, and search files. But what if we want to copy files or move them around or get rid of them? Most of the time, you can do these sorts of file manipulations without the command line, but there will be some cases (like when you’re working with a remote computer like we are for this lesson) where it will be impossible. You’ll also find that you may be working with hundreds of files and want to do similar manipulations to all of those files. In cases like this, it’s much faster to do these operations at the command line.

4.3.1 Copying Files

When working with computational data, it’s important to keep a safe copy of that data that can’t be accidentally overwritten or deleted. For this lesson, our raw data is our FASTQ files. We don’t want to accidentally change the original files, so we’ll make a copy of them and change the file permissions so that we can read from, but not write to, the files.

First, let’s make a copy of one of our FASTQ files using the cp command.

Navigate to the your directory, then move into yourdirectory/Week2/untrimmed_fastq with the fastq files we worked with last week. Once you are there, type:

$ cp SRR098026.fastq SRR098026-copy.fastq
$ ls -F

Copying large files can sometimes take some time, so you might have to wait a minute before your copy is made and you can write further commands.

SRR097977.fastq  SRR098026-copy.fastq  SRR098026.fastq

We now have two copies of the SRR098026.fastq file, one of them named SRR098026-copy.fastq. We’ll move this file to a new directory called backup where we’ll store our backup data files.

4.3.2 Creating Directories

The mkdir command is used to make a directory. Enter mkdir followed by a space, then the directory name you want to create.

$ mkdir backup

4.3.3 Moving / Renaming

We can now move our backup file to this directory. We can move files around using the command mv:

$ mv SRR098026-copy.fastq backup
$ ls backup
SRR098026-copy.fastq

The mv command is also how you rename files. Let’s rename this file to make it clear that this is a backup:

$ cd backup
$ mv SRR098026-copy.fastq SRR098026-backup.fastq
$ ls
SRR098026-backup.fastq

4.3.4 File Permissions

We’ve now made a backup copy of our files, but just because we have two copies, it doesn’t make us safe. We can still accidentally delete or overwrite both copies. To make sure we can’t accidentally mess up this backup file, we’re going to change the permissions on the file so that we’re only allowed to read (i.e. view) the file, not write to it (i.e. make new changes).

View the current permissions on a file using the -l (long) flag for the ls command:

$ ls -l
-rw-rw-r-- 1 kerickson kerickson 43K Jan 15 11:15 SRR098026-backup.fastq

The first part of the output for the -l flag gives you information about the file’s current permissions. There are ten slots in the permissions list. The first character in this list is related to file type, not permissions, so we’ll ignore it for now. The next three characters relate to the permissions that the file owner has, the next three relate to the permissions for group members, and the final three characters specify what other users outside of your group can do with the file. We’re going to concentrate on the three positions that deal with your permissions (as the file owner).

Permissions

Here the three positions that relate to the file owner are rw-. The r means that you have permission to read the file, the w indicates that you have permission to write to (i.e. make changes to) the file, and the third position is a -, indicating that you don’t have permission to carry out the ability encoded by that space (this is the space where x or executable ability is stored.

Our goal for now is to change permissions on this file so that you no longer have w or write permissions. We can do this using the chmod (change mode) command and subtracting (-) the write permission -w.

$ chmod -w SRR098026-backup.fastq
$ ls -l 
-r--r--r-- 1 dcuser dcuser 43332 Nov 15 23:02 SRR098026-backup.fastq

Chmod can also change the permission to only the user (u), group (g), and/or other (o). Let’s add reading (r), writing (x), and execute (x) permissions to user group.

$ chmod u=rwx SRR098026-backup.fastq
$ ls -l 

4.3.5 Removing

To prove to ourselves that you no longer have the ability to modify this file, try deleting it with the rm command:

$ rm SRR098026-backup.fastq

You’ll be asked if you want to override your file permissions:

rm: remove write-protected regular file ‘SRR098026-backup.fastq’? 

You should press n and the enter key for no. If you enter n (for no), the file will not be deleted. If you enter y, you will delete the file. This gives us an extra measure of security, as there is one more step between us and deleting our data files.

Important: The rm command permanently removes the file. Be careful with this command. There is no trash folder like you might have on your desktop. They’re really gone.

By default, rm will not delete directories. You can tell rm to delete a directory using the -r (recursive) option. Let’s delete the backup directory we just made.

Enter the following command:

$ cd ..
$ rm -r backup

This will delete the directory and all files within the directory. If you have write-protected files in the directory, you will be asked whether you want to override your permission settings. You can enter “y” this time so that we can have a clean slate to practice all the commands we just learned!

Class Exercise 1

Starting in ‘yourdirectory’, navigate to ‘cd /week2/untrimmed_fastq’ and do the following:

  1. Make sure that you have deleted your backup directory and all files it contains since we are going to do it again > but with less commands!

  2. Create a backup of each of your FASTQ files using cp, making sure to rename the copies in the process so that it’s clear they are the backup.

  3. Create a backup directory

  4. Use a wildcard to move all of your backup files to a new backup directory.

  5. Change the permissions on all of your backup files to be write-protected.

Bonus: If you finish early, deleted your backup directory and make a new one. Can you create a renamed copy of the file “SRR097977.fastq” in your backup directory using just one line of code?

4.4 Searching files

We discussed last week how to search within a file using less. We can also search within files without even opening them, using grep. grep is a command-line utility for searching plain-text files for lines matching a specific set of characters (sometimes called a string) or a particular pattern (which can be specified using something called regular expressions). We’re not going to work with regular expressions in this lesson, and are instead going to specify the strings we are searching for. Let’s give it a try!

Nucleotide abbreviations

The four nucleotides that appear in DNA are abbreviated A, C, T and G. Unknown nucleotides are represented with the letter N. An N appearing in a sequencing file represents a position where the sequencing machine was not able to confidently determine the nucleotide in that position. You can think of an N as being aNy nucleotide at that position in the DNA sequence.

We’ll search for strings inside of our fastq files. Let’s first make sure we are in the correct directory:

$ cd /group/rbaygrp/eve198-genomics/yourdirectory/week2/untrimmed_fastq

Suppose we want to see how many reads in our file have really bad segments containing 10 consecutive unknown nucleotides (Ns).To determine the quality of our data, we’re going to be manually searching for strings of Ns within our sequence results to illustrate some principles of file searching. It can be really useful to do this type of searching to get a feel for the quality of your sequencing results, however, in your research you will most likely use a bioinformatics tool that has a built-in program for filtering out low-quality reads. You’ll learn how to use one such tool in a later lesson.

Let’s search for the string NNNNNNNNNN in the SRR098026 file:

$ grep NNNNNNNNNN SRR098026.fastq

This command returns a lot of output to the terminal. Every single line in the SRR098026 file that contains at least 10 consecutive Ns is printed to the terminal, regardless of how long or short the file is.

We may be interested not only in the actual sequence which contains this string, but the other lines of information associated with this read (Recall that each line in a fasta file has 4 lines of information). If we want to see the read information or inspect the quality scores associated with each of these reads, we will return the line immediately before each match and the two lines immediately after each match.

We can use the -B argument for grep to return a specific number of lines before each match. The -A argument returns a specific number of lines after each matching line. Here we want the line before and the two lines after each matching line, so we add -B1 -A2 to our grep command:

$ grep -B1 -A2 NNNNNNNNNN SRR098026.fastq

One of the sets of lines returned by this command is:

@SRR098026.177 HWUSI-EAS1599_1:2:1:1:2025 length=35
CNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+SRR098026.177 HWUSI-EAS1599_1:2:1:1:2025 length=35
#!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

Class Exercise 2

  1. Search for the sequence GNATNACCACTTCC in the SRR098026.fastq file. Have your search return all matching lines and the name (or identifier) for each sequence that contains a match.

  2. Search for the sequence AAGTT in both FASTQ files. Have your search return all matching lines and the name (or identifier) for each sequence that contains a match.

4.5 Redirecting output

grep allowed us to identify sequences in our FASTQ files that match a particular pattern. All of these sequences were printed to our terminal screen, but in order to work with these sequences and perform other operations on them, we will need to capture that output in some way.

We can do this with something called “redirection”. The idea is that we are taking what would ordinarily be printed to the terminal screen and redirecting it to another location. In our case, we want to print this information to a file so that we can look at it later and use other commands to analyze this data.

The command for redirecting output to a file is >.

Let’s try out this command and copy all the records (including all four lines of each record) in our FASTQ files that contain ‘NNNNNNNNNN’ to another file called bad_reads.txt.

$ grep -B1 -A2 NNNNNNNNNN SRR098026.fastq > bad_reads.txt

4.6 File extensions

You might be confused about why we’re naming our output file with a .txt extension. After all, it will be holding FASTQ formatted data that we’re extracting from our FASTQ files. Won’t it also be a FASTQ file? The answer is, yes - it will be a FASTQ file and it would make sense to name it with a .fastq extension. However, using a .fastq extension will lead us to problems when we move to using wildcards later in this episode. We’ll point out where this becomes important. For now, it’s good that you’re thinking about file extensions!

The prompt should sit there a little bit, and then it should look like nothing happened. But type ls. You should see a new file called bad_reads.txt.

We can check the number of lines in our new file using a command called wc. wc stands for word count. This command counts the number of words, lines, and characters in a file. The FASTQ file may change over time, so given the potential for updates we are using a file downloaded in 2020.

The command wc gives the following output:

$ wc bad_reads.txt
  537  1073 23217 bad_reads.txt

This will tell us the number of lines, words and characters in the file. If we want only the number of lines, we can use the -l flag for lines.

$ wc -l bad_reads.txt
537 bad_reads.txt

We might want to search multiple FASTQ files for sequences that match our search pattern. However, we need to be careful, because each time we use the > command to redirect output to a file, the new output will replace the output that was already present in the file. This is called “overwriting” and, just like you don’t want to overwrite your video recording of your kid’s first birthday party, you also want to avoid overwriting your data files.

$ grep -B1 -A2 NNNNNNNNNN SRR098026.fastq > bad_reads.txt
$ wc -l bad_reads.txt
537 bad_reads.txt
$ grep -B1 -A2 NNNNNNNNNN SRR097977.fastq > bad_reads.txt
$ wc -l bad_reads.txt
0 bad_reads.txt

Here, the output of our second call to wc shows that we no longer have any lines in our bad_reads.txt file. This is because the second file we searched (SRR097977.fastq) does not contain any lines that match our search sequence. So our file was overwritten and is now empty.

We can avoid overwriting our files by using the command >>. >> is known as the “append redirect” and will append new output to the end of a file, rather than overwriting it.

$ grep -B1 -A2 NNNNNNNNNN SRR098026.fastq > bad_reads.txt
$ wc -l bad_reads.txt
537 bad_reads.txt
$ grep -B1 -A2 NNNNNNNNNN SRR097977.fastq >> bad_reads.txt
$ wc -l bad_reads.txt
537 bad_reads.txt

The output of our second call to wc shows that we have not overwritten our original data.

We can also do this with a single line of code by using a wildcard:

$ grep -B1 -A2 NNNNNNNNNN *.fastq > bad_reads.txt
$ wc -l bad_reads.txt
537 bad_reads.txt

File extensions - part 2

This is where we would have trouble if we were naming our output file with a .fastq extension. If we already had a file called bad_reads.fastq (from our previous grep practice) and then ran the command above using a .fastq extension instead of a .txt extension, grep would give us a warning.

grep -B1 -A2 NNNNNNNNNN *.fastq > bad_reads.fastq
grep: input file ‘bad_reads.fastq’ is also the output

grep is letting you know that the output file bad_reads.fastq is also included in your grep call because it matches the *.fastq pattern. Be careful with this as it can lead to some unintended results.

Since we might have multiple different criteria we want to search for, creating a new output file each time has the potential to clutter up our workspace. We also thus far haven’t been interested in the actual contents of those files, only in the number of reads that we’ve found. We created the files to store the reads and then counted the lines in the file to see how many reads matched our criteria. There’s a way to do this, however, that doesn’t require us to create these intermediate files - the pipe command (|).

What | does is take the output that is scrolling by on the terminal and uses that output as input to another command. When our output was scrolling by, we might have wished we could slow it down and look at it, like we can with less. Well it turns out that we can! We can redirect our output from our grep call through the less command.

$ grep -B1 -A2 NNNNNNNNNN SRR098026.fastq | less

We can now see the output from our grep call within the less interface. We can use the up and down arrows to scroll through the output and use q to exit less.

If we don’t want to create a file before counting lines of output from our grep search, we could directly pipe the output of the grep search to the command wc -l. This can be helpful for investigating your output if you are not sure you would like to save it to a file.

$ grep -B1 -A2 NNNNNNNNNN SRR098026.fastq | wc -l 

Because we asked grep for all four lines of each FASTQ record, we need to divide the output by four to get the number of sequences that match our search pattern. Since 802 / 4 = 200.5 and we are expecting an integer number of records, there is something added or missing in bad_reads.txt. If we explore bad_reads.txt using less, we might be able to notice what is causing the uneven number of lines. Luckily, this issue happens by the end of the file so we can also spot it with tail.

$ grep -B1 -A2 NNNNNNNNNN SRR098026.fastq > bad_reads.txt
$ tail bad_reads.txt
@SRR098026.133 HWUSI-EAS1599_1:2:1:0:1978 length=35
ANNNNNNNNNTTCAGCGACTNNNNNNNNNNGTNGN
+SRR098026.133 HWUSI-EAS1599_1:2:1:0:1978 length=35
#!!!!!!!!!##########!!!!!!!!!!##!#!
--
--
@SRR098026.177 HWUSI-EAS1599_1:2:1:1:2025 length=35
CNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+SRR098026.177 HWUSI-EAS1599_1:2:1:1:2025 length=35
#!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

The fifth and six lines in the output display “–” which is the default action for grep to separate groups of lines matching the pattern, and indicate groups of lines which did not match the pattern so are not displayed. To fix this issue, we can redirect the output of grep to a second instance of grep as follows.

$ grep -B1 -A2 NNNNNNNNNN SRR098026.fastq | grep -v '^--' > bad_reads.fastq
tail bad_reads.fastq
+SRR098026.132 HWUSI-EAS1599_1:2:1:0:320 length=35
#!!!!!!!!!##########!!!!!!!!!!##!#!
@SRR098026.133 HWUSI-EAS1599_1:2:1:0:1978 length=35
ANNNNNNNNNTTCAGCGACTNNNNNNNNNNGTNGN
+SRR098026.133 HWUSI-EAS1599_1:2:1:0:1978 length=35
#!!!!!!!!!##########!!!!!!!!!!##!#!
@SRR098026.177 HWUSI-EAS1599_1:2:1:1:2025 length=35
CNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+SRR098026.177 HWUSI-EAS1599_1:2:1:1:2025 length=35
#!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

The -v option in the second grep search stands for --invert-match meaning grep will now only display the lines which do not match the searched pattern, in this case '^--'. The caret (^) is an anchoring character matching the beginning of the line, and the pattern has to be enclose by single quotes so grep does not interpret the pattern as an extended option (starting with –).

Custom grep control

  1. Working indiviudally, use man grep to read more about other options to customize the output of grep. Pick one option, and try using it to display some lines from one of the fastq files.
  2. Share what option you picked with a neighbor and show them the output.

Redirecting output is often not intuitive, and can take some time to get used to. Once you’re comfortable with redirection, however, you’ll be able to combine any number of commands to do all sorts of exciting things with your data!

None of the command line programs we’ve been learning do anything all that impressive on their own, but when you start chaining them together, you can do some really powerful things very efficiently.

4.7 Writing Scripts and Working with Data

We’ve been able to do a lot of work with files that already exist, but what if we want to write our own files? We’re not going to type in a FASTA file, but we’ll see as we go through other tutorials, there are a lot of reasons we’ll want to write a file, or edit an existing file.

To add text to files, we’re going to use a text editor called Nano. We’re going to create a file to take notes about what we’ve been doing with the data files in ~/group/rbaygrp/eve198-genomics/yourdirectory/Week2/untrimmed_fastq.

This is good practice when working in bioinformatics. We can create a file called README.txt that describes the data files in the directory or documents how the files in that directory were generated. As the name suggests, it’s a file that we or others should read to understand the information in that directory.

Let’s change our working directory to ~/group/rbaygrp/eve198-genomics/yourdirectory/Week2/untrimmed_fastq using cd, then run nano to create a file called README.txt:

$ cd ~/group/rbaygrp/eve198-genomics/yourdirectory/Week2/untrimmed_fastq
$ nano README.txt

You should see something like this:

nano201711.png

The text at the bottom of the screen shows the keyboard shortcuts for performing various tasks in nano. We will talk more about how to interpret this information soon.

Which Editor?

Which Editor?

When we say, “nano is a text editor,” we really do mean “text”: it can only work with plain character data, not tables, images, or any other human-friendly media. We use it in examples because it is one of the least complex text editors. However, because of this trait, it may not be powerful enough or flexible enough for the work you need to do after this workshop. On Unix systems (such as Linux and Mac OS X), many programmers use Emacs or Vim (both of which require more time to learn), or a graphical editor such as Gedit. On Windows, you may wish to use Notepad++. Windows also has a built-in editor called notepad that can be run from the command line in the same way as nano for the purposes of this lesson.

No matter what editor you use, you will need to know where it searches for and saves files. If you start it from the shell, it will (probably) use your current working directory as its default location. If you use your computer’s start menu, it may want to save files in your desktop or documents directory instead. You can change this by navigating to another directory the first time you “Save As…”

 

Let’s type in a few lines of text. Describe what the files in this directory are or what you’ve been doing with them. Once we’re happy with our text, we can press Ctrl-O (press the Ctrl or Control key and, while holding it down, press the O key) to write our data to disk. You’ll be asked what file we want to save this to: press Return to accept the suggested default of README.txt.

Once our file is saved, we can use Ctrl-X to quit the editor and return to the shell.

Control, Ctrl, or ^ Key

The Control key is also called the “Ctrl” key. There are various ways in which using the Control key may be described. For example, you may see an instruction to press the Ctrl key and, while holding it down, press the X key, described as any of:

  • Control-X
  • Control+X
  • Ctrl-X
  • Ctrl+X
  • ^X
  • C-x

In nano, along the bottom of the screen you’ll see ^G Get Help ^O WriteOut. This means that you can use Ctrl-G to get help and Ctrl-O to save your file.

Now you’ve written a file. You can take a look at it with less or cat, or open it up again and edit it with nano.

4.8 Writing scripts: Bash

A really powerful thing about the command line is that you can write scripts. Scripts let you save commands to run them and also lets you put multiple commands together. Though writing scripts may require an additional time investment initially, this can save you time as you run them repeatedly. Scripts can also address the challenge of reproducibility: if you need to repeat an analysis, you retain a record of your command history within the script.

One thing we will commonly want to do with sequencing results is pull out bad reads and write them to a file to see if we can figure out what’s going on with them. We’re going to look for reads with long sequences of N’s like we did before, but now we’re going to write a script, so we can run it each time we get new sequences, rather than type the code in by hand each time.

We’re going to create a new file to put this command in. We’ll call it bad-reads-script.sh. The sh isn’t required, but using that extension tells us that it’s a shell script.

$ nano bad-reads-script.sh

Bad reads have a lot of N’s, so we’re going to look for NNNNNNNNNN with grep. We want the whole FASTQ record, so we’re also going to get the one line above the sequence and the two lines below. We also want to look in all the files that end with .fastq, so we’re going to use the * wildcard.

grep -B1 -A2 -h NNNNNNNNNN *.fastq | grep -v '^--' > scripted_bad_reads.txt

Custom grep control

We introduced the -v option in the previous lesson, now we are using -h to “Suppress the prefixing of file names on output” according to the documentation shown by man grep.

Type your grep command into the file and save it as before. Be careful that you did not add the $ at the beginning of the line.

Now comes the neat part. We can run this script. Type:

$ bash bad-reads-script.sh

It will look like nothing happened, but now if you look at scripted_bad_reads.txt, you can see that there are now reads in the file.

If we want our ‘bad-reads-script.sh’ to tell us when it is done running, we can add this line at the end:

echo "Script finished!"

If you run the bash bad-reads-script.sh command again and it will print out “Script finished!”

4.9 Group Work Activity- Writing your own script

modified from https://www.cyberciti.biz/faq/hello-world-bash-shell-script/

Now let’s work in small groups to write our own scripts. The script should be called “hello.sh” and you want it to write a text file that says “Hello World! Isn’t genomics so fun?”

Submit a copy of your script on canvas under the ‘Assignments’ tab for ‘Week 3: Writing your own script’.

4.10 Key Points

  • The commands cp, mv, and mkdir are useful for manipulating existing files and creating new directories.

  • You can view file permissions using ls -l and change permissions using chmod.

  • grep is a powerful search tool with many options for customization.

  • >, >>, and | are different ways of redirecting output.

  • command > file redirects a command’s output to a file whle command >> file redirects a command’s output to a file without overwriting the existing contents of the file.

  • command_1 | command_2 redirects the output of the first command as input to the second command.

  • Scripts are a collection of commands executed together.

Class Exercise Solutions

Exercise: Solutions

Exercise 1: Solution

  1. rm -r backup
  2. cp SRR098026.fastq SRR098026-backup.fastq and cp SRR097977.fastq SRR097977-backup.fastq
  3. mkdir backup and mv *-backup.fastq backup
  4. chmod -w backup/*-backup.fastq
    It’s always a good idea to check your work with ls -l backup. You should see something like:
-r--r--r-- 1 dcuser dcuser 47552 Nov 15 23:06 SRR097977-backup.fastq
-r--r--r-- 1 dcuser dcuser 43332 Nov 15 23:06 SRR098026-backup.fastq

Exercise 2: Solution

  1. grep -B1 GNATNACCACTTCC SRR098026.fastq

    @SRR098026.245 HWUSI-EAS1599_1:2:1:2:801 length=35
    GNATNACCACTTCCAGTGCTGANNNNNNNGGGATG
  2. grep -B1 AAGTT *.fastq

    SRR097977.fastq-@SRR097977.11 209DTAAXX_Lenski2_1_7:8:3:247:351 length=36
    SRR097977.fastq:GATTGCTTTAATGAAAAAGTCATATAAGTTGCCATG
    --
    SRR097977.fastq-@SRR097977.67 209DTAAXX_Lenski2_1_7:8:3:544:566 length=36
    SRR097977.fastq:TTGTCCACGCTTTTCTATGTAAAGTTTATTTGCTTT
    --
    SRR097977.fastq-@SRR097977.68 209DTAAXX_Lenski2_1_7:8:3:724:110 length=36
    SRR097977.fastq:TGAAGCCTGCTTTTTTATACTAAGTTTGCATTATAA
    --
    SRR097977.fastq-@SRR097977.80 209DTAAXX_Lenski2_1_7:8:3:258:281 length=36
    SRR097977.fastq:GTGGCGCTGCTGCATAAGTTGGGTTATCAGGTCGTT
    --
    SRR097977.fastq-@SRR097977.92 209DTAAXX_Lenski2_1_7:8:3:353:318 length=36
    SRR097977.fastq:GGCAAAATGGTCCTCCAGCCAGGCCAGAAGCAAGTT
    --
    SRR097977.fastq-@SRR097977.139 209DTAAXX_Lenski2_1_7:8:3:703:655 length=36
    SRR097977.fastq:TTTATTTGTAAAGTTTTGTTGAAATAAGGGTTGTAA
    --
    SRR097977.fastq-@SRR097977.238 209DTAAXX_Lenski2_1_7:8:3:592:919 length=36
    SRR097977.fastq:TTCTTACCATCCTGAAGTTTTTTCATCTTCCCTGAT
    --
    SRR098026.fastq-@SRR098026.158 HWUSI-EAS1599_1:2:1:1:1505 length=35
    SRR098026.fastq:GNNNNNNNNCAAAGTTGATCNNNNNNNNNTGTGCG

4.11 Additional Information

4.11.1 Uploading and Downloading Data to your Virtual Machine with scp - UNIX

This section is for your general knowledge.

scp stands for ‘secure copy protocol’, and is a widely used UNIX tool for moving files between computers. The simplest way to use scp is to run it in your local terminal, and use it to copy a single file:

scp <file I want to move> <where I want to move it>

In terminal,you can use the scp command to upload a file (e.g. local_file.txt) to the cluster home directory:

$  scp local_file.txt UserName@cluster.address:/scratch/

If you wanted to download data from your virtual machine, we would put the location of the folder within the virtual machine in the location of

$  scp UserName@cluster.address:/scratch/VirtualMachine_file.txt /group/rbaygrp/eve198-genomics/`yourdirectory`/Week2/untrimmed_fastq/

4.12 More ways to work with files

4.12.1 Awk

Awk is a fast and versatile pattern matching programming language. Awk can do the same tasks that sed, grep, cat, and wc; and then it can do a lot more https://www.gnu.org/software/gawk/manual/gawk.html. This program deserves a full class to go into details, so instead we just have this section to make you aware that the program exists.

Let’s see how awk can behave like wc.

$ cd /group/rbaygrp/eve198-genomics/`yourdirectory`/Week2
$ ls TableS2_QTL_Bay_2017.txt  sra_metadata  untrimmed_fastq

This table is from the Bay et al. 2017 publication TableS2_QTL_Bay_2017.txt and we will use it as our example file for this section.

We can look inside the file by using cat or awk

$ awk '{print $0}' TableS2_QTL_Bay_2017.txt

The instructions are enclosed in single quotes

This command has the same output of “cat”: it prints each line from the example file TableS2_QTL_Bay_2017.txt

The structure of the instruction is the following: - curly braces surround the set of instructions - print is the instruction that sends its arguments to the terminal - $0 is a variable, it means “the content of the current line”

As you can see, the file contains a table.

Trait   n   LOD Chr Position (cM)   Nearest SNP 
mate choice 200 4.5 14  22.43   chrXIV:1713227 
mate choice     200 4.61    21  8   chrXXI:9373717 
discriminant function   200 4.83    12  17  chrXII:7504339 
discriminant function   200 4.23    14  8.1 chrXIV:4632223 
PC2 200 4.04    4   30.76   chrIV:11367975 
PC2 200 6.67    7   47  chrVII:26448674 
centroid size   200 6.97    9   47.8    chrIX:19745222 
x2* 200 3.93    7   60  chrUn:29400087 
y2* 200 9.99    4   32  chrIV:11367975 
x3  200 4.45    1   32.3    chrI:15145305 
x4  200 5.13    16  30.9    chrXVI:12111717 
x5* 200 4.54    15  6   chrXV:505537 
y5  200 4.21    4   24.9    chrIV:15721538 
x6  200 3.96    16  29.5    chrXVI:13588796 
y6* 200 4.14    9   30.2    chrIX:18942598 
y15*    200 5.3 2   27  chrII:19324477 
x16 200 5.49    7   60  chrUn:29400087 
x17     200 4.92    1   32.8    chrI:14261764 
Table S2. Significant QTL loci for mate choice and morphology

Now let’s use awk to count the lines of a file, similarly to what wc -l would do.

As you probably remember, -l is an option that asks for the number of lines only.

However, wc counts the number of newlines in the file, if the last line does not contain a carriage return (i.e. there is no emptyline at the end of the file), the result is going be the actual number of lines minus one.

$ wc -l TableS2_QTL_Bay_2017.txt
19 TableS2_QTL_Bay_2017.txt

A workaround is to use awk. Awk is command line program that takes as input a set of instructions and one or more files. The instructions are executed on each line of the input file(s).

$ awk '{print NR;}' TableS2_QTL_Bay_2017.txt | tail -1

Awk can also search within a file like grep can. Let’s see if there are any significant QTL loci in the chromosome “chrXIV”

$ awk '/chrXIV/' TableS2_QTL_Bay_2017.txt

This chromosome had two significant QTL Loci for mate choice and morphology.

When to use awk?

  • for search and replacement of large files (it’s fast!)
  • when manipulating multiple large files